Lugha ya Kuprogramu ya R Jobs

R is an open source programming language for statistical computing and graphics, it is widely used by statisticians and data miners.

Ajiri R Programmers

Kichujio

Utafutaji wangu
Chuja ukitumia:
Bajeti
hadi
hadi
hadi
Aina
Ujuzi
Lugha
    Jimbo la Kazi
    77 kazi zimepatikana, bei imeletwa USD
    R programming project 6 siku left
    DHIBITISHWA

    Need an R expert to interpret coding results.

    $23 (Avg Bid)
    $23 Wastani wa Zabuni
    2 zabuni
    * SAS Program 6 siku left

    SAS (Statistical Analysis System) problem solving using SAS software.

    $26 (Avg Bid)
    $26 Wastani wa Zabuni
    3 zabuni

    The aim of this project is to explore the tools provided by the programming languages Julia, Python, R, and Octave to handle missing data. For that purpose, you have to study some famous libraries of the previously mentioned programming languages with some examples for illustration. In addition, you have to do a comparative study between them based on one or several examples. The comparative study...

    $21 (Avg Bid)
    $21 Wastani wa Zabuni
    2 zabuni
    machine learning 6 siku left
    DHIBITISHWA

    Cross-validation in Machine Learning Data distribution for cross validation at k = 3 blocks ? Block 1 Block 2 Block 3 1 Validation Learning Learning 2 Learning Validation Learning 3 Learning Learning Validation

    $19 (Avg Bid)
    $19 Wastani wa Zabuni
    7 zabuni
    MNIST / Fashion MNIST image data 6 siku left
    DHIBITISHWA

    Need a fully executed R-Markdown program performing clustering using SOM and LLE on the image data containing MNIST (digits) and Fashion MNIST (apparel) images that are 28 x 28 pixels resolution. Make sure to describe the final hyperparameter settings of all algorithms that were used for comparison purposes.

    $25 (Avg Bid)
    $25 Wastani wa Zabuni
    2 zabuni

    Need a tutor for R programming language. Tutor needs to have expert knowledge of R programming language and generating graphs with R. Tutor should be comfortable in analyzing datasets using R programming language and use data visualization softwares such as Gephi or R. Topics will cover analyzing datasets, writing R scripts to generate node centralities and values. It will be a big plus point if...

    $14 / hr (Avg Bid)
    $14 / hr Wastani wa Zabuni
    5 zabuni

    The work is for a systematic review and we need to calculate effect sizes.

    $305 (Avg Bid)
    $305 Wastani wa Zabuni
    5 zabuni
    Independent Cascade model 6 siku left
    DHIBITISHWA

    Create a network given a graph in R For ICM, use the edge weight (probabilities) For LTM, use 5 different a and b values, record the number of nodes that are activated

    $18 (Avg Bid)
    $18 Wastani wa Zabuni
    2 zabuni
    Statistical 6 siku left

    Statistical project with R .

    $220 (Avg Bid)
    $220 Wastani wa Zabuni
    23 zabuni

    Sampling theory & application assignments, 4 questions, not too long

    $21 (Avg Bid)
    $21 Wastani wa Zabuni
    12 zabuni

    Real Estate Finance in R Studio. R Code with brief comments

    $51 (Avg Bid)
    $51 Wastani wa Zabuni
    3 zabuni

    Coding for Real Estate Finance, estimated time for someone experienced: 1-2h. Supporting documents will be provided. I would need it today 8 pm CET. I need R Code with brief comments

    $30 (Avg Bid)
    $30 Wastani wa Zabuni
    1 zabuni

    Coding for Real Estate Finance Supporting documents will be provided. I would need it today 11pm CET. Deliverables R Code with brief comments

    $10 - $30
    $10 - $30
    0 zabuni
    Help with STATA 5 siku left
    DHIBITISHWA

    I am doing a research on the effect of asylum seeker reception centers on the property value of nearby houses. For this I need to preform a difference in difference analysis (hedonic price model) in fact it is a multi regression. I need some help with creating dummies and preform some other actions. Is there someone out here that is good with STATA?

    $170 (Avg Bid)
    $170 Wastani wa Zabuni
    16 zabuni

    Data Analyst Experte, R Programming gesucht Suche einen Experten für Datenbankenanalyse in R der bei einem privaten Projekt behilflich sein kann. Grob umschrieben die Hilfe zuerst bei 1) Daten Cleaning > Daten auf den selben Nenner bringen, damit sie verglichen werden können und dann 2) die Daten (es handelt sich im Zeitreihendaten für 12 Jahre Zeitraum) mit Hilfe einer passenden...

    $19 / hr (Avg Bid)
    $19 / hr Wastani wa Zabuni
    3 zabuni

    We are looking for statistics writers for long term work, urgently need to be done a biostatistics task using R programming. Once we contact, you have to provide your previous writing samples (note that not stolen ones). If you are interested, answer the following questions: 1. Your highest education degree and subject? 2. Which types of writing experiences do you have? 3. What referencing styles...

    $12 (Avg Bid)
    $12 Wastani wa Zabuni
    3 zabuni

    Need to run Monte Carlo Simulations on the provide data.

    $95 (Avg Bid)
    $95 Wastani wa Zabuni
    7 zabuni

    I am trying to evaluate an optimal purchase strategy for a battery storage. I have a data set with bid and ask prices and would like to have the best strategy of buying and selling under a number of constraints. I am struggling to code my objective using lpsolve().

    $86 (Avg Bid)
    $86 Wastani wa Zabuni
    10 zabuni
    SAS Program 4 siku left

    SAS (Statistical Analysis System) problem solving using SAS software.

    $23 (Avg Bid)
    $23 Wastani wa Zabuni
    7 zabuni
    Data Mining - Weka 4 siku left
    DHIBITISHWA

    Use Weka to do the following: A. Classification and Prediction 1. Classification • Select dataset from UCI/kaggle repository* or from any other source. The first dataset should have continuous value for the class. • Apply on dataset classification with neural networks using backpropagation algorithm. Use various learning parameters with different number of epochs and record your notic...

    $167 (Avg Bid)
    $167 Wastani wa Zabuni
    15 zabuni
    R Studio Expert is Required 4 siku left
    DHIBITISHWA

    I am looking for RStudio Expert to help me out with the small task

    $18 (Avg Bid)
    $18 Wastani wa Zabuni
    8 zabuni

    R Implementing Particle Swarm Optimization to optimize parameters for sports rating system

    $12 / hr (Avg Bid)
    $12 / hr Wastani wa Zabuni
    4 zabuni

    R Implementing Particle Swarm Optimization to optimize parameters for sports rating system

    $23 (Avg Bid)
    $23 Wastani wa Zabuni
    10 zabuni

    The data in Table 9.13 are numbers of insurance policies, n, and numbers of claims, y, for cars in various insurance categories, CAR, tabulated by age of policy holder, AGE, and district where the policy holder lived (DIST = 1, for London and other major cities, and DIST = 0, otherwise). The table is derived from the CLAIMS data set in Aitkin et al. (2005) obtained from a paper by Baxter et al. (1...

    $55 (Avg Bid)
    $55 Wastani wa Zabuni
    2 zabuni

    8.2.) The data in Table 9.13 are numbers of insurance policies, n, and numbers of claims, y, for cars in various insurance categories, CAR, tabulated by age of policy holder, AGE, and district where the policy holder lived (DIST = 1, for London and other major cities, and DIST = 0, otherwise). The table is derived from the CLAIMS data set in Aitkin et al. (2005) obtained from a paper by Baxter et ...

    $73 (Avg Bid)
    $73 Wastani wa Zabuni
    3 zabuni

    Need someone who is expert in R language Thanks

    $25 (Avg Bid)
    $25 Wastani wa Zabuni
    8 zabuni

    Recreate methods: dea, [ingia ili uone URL], sdea and malmquist form Package ‘Benchmarking’ from R to Python

    $10 (Avg Bid)
    $10 Wastani wa Zabuni
    1 zabuni

    r coding , data analysis are needed in the project

    $248 (Avg Bid)
    $248 Wastani wa Zabuni
    10 zabuni

    To use programming skills and knock down the data and create tools that can ease the process of data analysis.

    $848 (Avg Bid)
    $848 Wastani wa Zabuni
    6 zabuni
    Economic´╝îstatistics ,R,stata 4 siku left
    DHIBITISHWA

    This questions asks you to estimate the causal effect of tourism on local household incomes in Mexico. To answer this question, we will use Stata/R and the dataset “[ingia ili uone URL]” that you can download from BCourses. This dataset contains 1153 Mexican municipalities that reported some amount of local tourism activity (measured by local hotel sales) in the year 2000. Write up t...

    $147 (Avg Bid)
    $147 Wastani wa Zabuni
    12 zabuni
    $63 Wastani wa Zabuni
    6 zabuni
    R project 4 siku left
    DHIBITISHWA

    See the description from the picture

    $20 (Avg Bid)
    $20 Wastani wa Zabuni
    11 zabuni
    Mathematica project -- 2 4 siku left
    DHIBITISHWA

    The project is devoted to practical issues of "Evaluation of Engineering" course. It is dedicated to statistical analysis of real-world data using using an advanced computational tool-Wolfram Mathematica....

    $25 (Avg Bid)
    $25 Wastani wa Zabuni
    2 zabuni

    Hello everyone, I will need an expert in Statistics that can do a a regression analysis in R. The project is related to topic modelling. I will send you the analytical requirements and data in chat Best

    $63 (Avg Bid)
    $63 Wastani wa Zabuni
    11 zabuni

    Portfolio Rebalancing project. I need you to create a code which creates sectorial subindexes for one given big index, like the S&P500. I need a file containing the sectors and the weights of the components of the S&P500 at a given date and the code has to generate n different files with the composition of the n sectorial subindexes with weights rebalanced, where n is the number of differe...

    $175 (Avg Bid)
    $175 Wastani wa Zabuni
    12 zabuni

    I want to write a code for a variational autoencoder (with time series data) and I don't know where to start. It is for my thesis so very important. The data consists of multiple timepoints and a lot of different variables per timestep, i dont know how to impute these timepoints. Should I impute them all in once or per timestep > what kind of preprocessing steps should i do > etc.

    $129 (Avg Bid)
    $129 Wastani wa Zabuni
    11 zabuni

    I'm looking for a freelance to support the new ML division lunch or to join the company. The concept is to use out-of-the-box tools and pre-trained models as much as possible and to create a scalable solution to be delivered to our >400 clients around the world (Luftansa, Swiss, Fiat, MobileEye, Playtica, IronSource...).

    $53 / hr (Avg Bid)
    $53 / hr Wastani wa Zabuni
    2 zabuni
    Application Development on R 3 siku left
    DHIBITISHWA

    Create applications in R Implement vulnerabilities in these applications. Develop secure and insecure solutions for the vulnerable code Create training modules based on the developed code.

    $255 (Avg Bid)
    $255 Wastani wa Zabuni
    4 zabuni

    I need to run my R code from a website, basically, on some user submission the code executed and the return response to be displayed back on the website

    $6 / hr (Avg Bid)
    $6 / hr Wastani wa Zabuni
    2 zabuni

    Looking for someone to come in, link R shiny to our web host server! We have developed RShiny apps, and now want to create a website. If you have created a website using R Shiny you are the perfect person for this job! Thank you!

    $108 (Avg Bid)
    $108 Wastani wa Zabuni
    3 zabuni

    Statistical analysis is needed to be done for a secondary database, which needs descriptive statistical analysis to see the relationship between dependent and independent variables, also Chi-square tests and Logistic regression analysis. For a cross-sectional study in malnutrition.

    $115 (Avg Bid)
    $115 Wastani wa Zabuni
    32 zabuni
    Genomics Variants Exploration -- 2 2 siku left
    DHIBITISHWA

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    $5 / hr (Avg Bid)
    $5 / hr Wastani wa Zabuni
    5 zabuni

    Lets discuss more detail via zoom It may help to know that the project is to reproduce one of the tabs depicted here: [ingia ili uone URL]

    $35 (Avg Bid)
    $35 Wastani wa Zabuni
    5 zabuni

    are you know Rshiny well? Lets discuss more detail via zoom

    $15 (Avg Bid)
    $15 Wastani wa Zabuni
    1 zabuni

    are you know Rshiny well? if right, it will okay. Lets discuss more detail via zoom

    $27 (Avg Bid)
    $27 Wastani wa Zabuni
    5 zabuni

    I have the code for the graph itself completed, but need help with the RShiny component of the work (reactives, etc.).

    $10 - $30
    $10 - $30
    0 zabuni
    SAS Programming 2 siku left

    Looking for a SAS programmer to work on my Project

    $1176 (Avg Bid)
    $1176 Wastani wa Zabuni
    7 zabuni

    Looking for SAS programmer to guide in my new project

    $1267 (Avg Bid)
    $1267 Wastani wa Zabuni
    7 zabuni

    Looking for a SAS programmer who can guide me in my project

    $1181 (Avg Bid)
    $1181 Wastani wa Zabuni
    4 zabuni
    Thesis Paper -- 2 1 siku left
    DHIBITISHWA

    Writing a thesis paper, extracting datas and know a statistical software ( Stata or R).

    $88 (Avg Bid)
    $88 Wastani wa Zabuni
    39 zabuni