Bayoteknolojia Jobs

Biotechnology is an area of science that encompasses biological systems and living organisms in order to make or modify products or processes. Various processes related to biotechnology such as research and development, documentation, etc. can be outsourced to freelancers. Expert freelancers with biotechnology knowledge and qualifications are available to bid on projects. To get started, post your job today. Ajiri Biotechnology Experts

Kichujio

Utafutaji wangu
Chuja ukitumia:
Bajeti
hadi
hadi
hadi
Aina
Ujuzi
Lugha
    Jimbo la Kazi
    10 kazi zimepatikana, bei imeletwa USD
    Biology project needed 6 siku left
    DHIBITISHWA

    please contact me if you are a biology expert

    $13 (Avg Bid)
    $13 Wastani wa Zabuni
    3 zabuni
    pharm chemistry 6 siku left
    DHIBITISHWA

    Hi there .. i am looking for some help with my pharm chemistry .. please bid if you can help me

    $10 - $30
    Imefichwa
    $10 - $30
    11 zabuni
    Biochemistry Expert Needed 5 siku left
    DHIBITISHWA

    Biochemistry Expert Needed for Urgent work

    $17 (Avg Bid)
    $17 Wastani wa Zabuni
    7 zabuni
    Biotechnological Tutor 5 siku left
    DHIBITISHWA

    I need online personal tution.

    $48 (Avg Bid)
    $48 Wastani wa Zabuni
    10 zabuni

    Online tutor need to learn Chemistry i can send the study material so you can check it and then let me know if you can help.

    $37 (Avg Bid)
    $37 Wastani wa Zabuni
    18 zabuni

    Hello I need an expert in Organic Chemistry urgently Please apply if you have the right expertise.

    $72 (Avg Bid)
    $72 Wastani wa Zabuni
    17 zabuni

    Using the BLAT tool on Ensembl and NCBI BLAST/ RARA protein sequencing

    $202 (Avg Bid)
    $202 Wastani wa Zabuni
    9 zabuni

    it's a project's review paper which has to be written. The material will be provided by me.

    $17 (Avg Bid)
    $17 Wastani wa Zabuni
    9 zabuni
    Genomics Variants Exploration -- 2 2 siku left
    DHIBITISHWA

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    $5 / hr (Avg Bid)
    $5 / hr Wastani wa Zabuni
    5 zabuni
    Help with chemistry 23 masaa left

    I need help solving 2 organic chemistry questions for today!

    $7 / hr (Avg Bid)
    $7 / hr Wastani wa Zabuni
    21 zabuni